pspcas9 bb 2a puro plasmid (Addgene inc)
Addgene inc is a verified supplier 
96
Structured Review
Addgene inc
pspcas9 bb 2a puro plasmid
Pspcas9 Bb 2a Puro Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 2950 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/px459+v2+0/pSpCas9(BB)-2A-Puro+(PX459)+V2%2E0+(Plasmid+%2362988)/pm42848794-247-11-13
Average 96 stars, based on 2950 article reviews
Pspcas9 Bb 2a Puro Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 2950 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/px459+v2+0/pSpCas9(BB)-2A-Puro+(PX459)+V2%2E0+(Plasmid+%2362988)/pm42848794-247-11-13
Average 96 stars, based on 2950 article reviews
pspcas9 bb 2a puro plasmid - by Bioz Stars,
2026-10
96/100 stars
Images
Related Articles
Clone Assay:Article Title: MuSK is a substrate for CaMK2β but this interaction is dispensable for MuSK activation in vivo Article Snippet: .. Oligonucleotides encoding Cas9-target sequences on exon 2 or exon 8 of the murine Camk2b gene were obtained from Microsynth (Balgach, Switzerland) and cloned into Article Title: Lamin A/C-regulated cysteine catabolic flux modulates stem cell fate through epigenome reprogramming Article Snippet: .. Annealed gRNAs were cloned into Article Title: Lamin A/C-regulated cysteine catabolic flux modulates stem cell fate through epigenome reprogramming. Article Snippet: .. Annealed gRNAs were cloned into Plasmid Preparation:Article Title: MuSK is a substrate for CaMK2β but this interaction is dispensable for MuSK activation in vivo Article Snippet: .. Oligonucleotides encoding Cas9-target sequences on exon 2 or exon 8 of the murine Camk2b gene were obtained from Microsynth (Balgach, Switzerland) and cloned into Article Title: Quantification profiles of enzyme activity, secretion, and psychosine levels of Krabbe disease galactosylceramidase missense variants Article Snippet: .. Guided RNA targeting sequence 1 (sgRNA-GALC1: 5′ GAAAGCTATGACTGCGGCCG 3′) and 2 (sgRNA-GALC2: 5′ TACGTGCTCGACGACTCCGA 3′) were subcloned individually into Article Title: Prediction of the hypothalamus-pituitary organoid formation using machine learning Article Snippet: .. Amplification:Article Title: Engineered AcrIIA5 for optogenetic control of CRISPR‐Cas9‐based genome editing Article Snippet: Site‐directed mutagenesis of AsLOV2 was performed using Mut Express II Fast Mutagenesis Kit V2 (Vazyme). .. The DNA fragments of SpCas9 , SaCas9 , NmeCas9 , and St1Cas9 were amplified from Article Title: Engineered AcrIIA5 for optogenetic control of CRISPR‐Cas9‐based genome editing Article Snippet: Site‐directed mutagenesis of AsLOV2 was performed using Mut Express II Fast Mutagenesis Kit V2 (Vazyme). .. The DNA fragments of SpCas9, SaCas9, NmeCas9, and St1Cas9 were amplified from Sequencing:Article Title: Quantification profiles of enzyme activity, secretion, and psychosine levels of Krabbe disease galactosylceramidase missense variants Article Snippet: .. Guided RNA targeting sequence 1 (sgRNA-GALC1: 5′ GAAAGCTATGACTGCGGCCG 3′) and 2 (sgRNA-GALC2: 5′ TACGTGCTCGACGACTCCGA 3′) were subcloned individually into Transfection:Article Title: Lamin A/C-regulated cysteine catabolic flux modulates stem cell fate through epigenome reprogramming Article Snippet: .. Annealed gRNAs were cloned into Article Title: Lamin A/C-regulated cysteine catabolic flux modulates stem cell fate through epigenome reprogramming. Article Snippet: .. Annealed gRNAs were cloned into |
